ID: 935146590_935146598

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 935146590 935146598
Species Human (GRCh38) Human (GRCh38)
Location 2:100399662-100399684 2:100399676-100399698
Sequence CCCCCTCAGGGCCCCCCACCCAG CCCACCCAGCTCTTCCTTTATGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 9, 3: 72, 4: 659} {0: 1, 1: 0, 2: 0, 3: 19, 4: 240}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!