ID: 935197041_935197046

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 935197041 935197046
Species Human (GRCh38) Human (GRCh38)
Location 2:100822980-100823002 2:100822993-100823015
Sequence CCTCGTTCTATTTGTAGCAAAGA GTAGCAAAGATGGGAGGTCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 121} {0: 1, 1: 0, 2: 0, 3: 21, 4: 199}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!