ID: 935199683_935199685

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 935199683 935199685
Species Human (GRCh38) Human (GRCh38)
Location 2:100845417-100845439 2:100845442-100845464
Sequence CCATTGTCCATTTGTACATTCAG TCTCAGTGCCAATGTAGCACTGG
Strand - +
Off-target summary {0: 2, 1: 17, 2: 53, 3: 92, 4: 431} {0: 1, 1: 0, 2: 0, 3: 14, 4: 96}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!