ID: 935308821_935308826

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 935308821 935308826
Species Human (GRCh38) Human (GRCh38)
Location 2:101762508-101762530 2:101762558-101762580
Sequence CCATTCAACCCTGAGTACAGAAG CAGCTCTTGTAGAGGTAAAACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 116} {0: 1, 1: 0, 2: 2, 3: 9, 4: 224}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!