ID: 935335528_935335532

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 935335528 935335532
Species Human (GRCh38) Human (GRCh38)
Location 2:102012302-102012324 2:102012338-102012360
Sequence CCTTCCACCAGCTGGCTTCAGAG TAAACTCATTTGACTTAAGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 319} {0: 1, 1: 0, 2: 2, 3: 16, 4: 190}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!