ID: 935368709_935368714

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 935368709 935368714
Species Human (GRCh38) Human (GRCh38)
Location 2:102322077-102322099 2:102322113-102322135
Sequence CCTGGCAGTCTAAAAGCTACAAG CTGGAAATTCAGATAAGAGTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 96} {0: 1, 1: 0, 2: 5, 3: 25, 4: 261}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!