ID: 935406846_935406852

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 935406846 935406852
Species Human (GRCh38) Human (GRCh38)
Location 2:102718581-102718603 2:102718603-102718625
Sequence CCACTGCAGTCACAGACTGCCCC CACGCCAATAAGGGTGCCGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 319} {0: 1, 1: 0, 2: 0, 3: 1, 4: 28}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!