ID: 935457772_935457775

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 935457772 935457775
Species Human (GRCh38) Human (GRCh38)
Location 2:103290028-103290050 2:103290073-103290095
Sequence CCTACTTAAAAGAGGTATTTCTG GAATTATTTTTTCCACAGGAAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 27, 4: 317}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!