ID: 935483548_935483553

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 935483548 935483553
Species Human (GRCh38) Human (GRCh38)
Location 2:103623725-103623747 2:103623774-103623796
Sequence CCCTCATCTATGTGAAGATCTCT ATTGCCAGAGACAAGGAAGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 194} {0: 1, 1: 0, 2: 2, 3: 25, 4: 331}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!