ID: 935692620_935692631

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 935692620 935692631
Species Human (GRCh38) Human (GRCh38)
Location 2:105744889-105744911 2:105744921-105744943
Sequence CCGCCGCTGCCGCGGGGATCGTC CCGCGCGGCCGAGCGGGCGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 80} {0: 1, 1: 0, 2: 3, 3: 39, 4: 542}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!