ID: 935947608_935947611

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 935947608 935947611
Species Human (GRCh38) Human (GRCh38)
Location 2:108300481-108300503 2:108300497-108300519
Sequence CCTGCTGCAGGCACATGGGGGTC GGGGGTCATCTCTGGCTGGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 193} {0: 1, 1: 0, 2: 3, 3: 99, 4: 691}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!