ID: 936013879_936013885

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 936013879 936013885
Species Human (GRCh38) Human (GRCh38)
Location 2:108943302-108943324 2:108943351-108943373
Sequence CCTGGGAGAAACAGAGGGGAGGC AGAGTAAAACCTTTCATTTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 8, 3: 45, 4: 341} {0: 1, 1: 1, 2: 8, 3: 34, 4: 349}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!