ID: 936045758_936045762

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 936045758 936045762
Species Human (GRCh38) Human (GRCh38)
Location 2:109186649-109186671 2:109186675-109186697
Sequence CCCTAGGAAGACCCTGCGGGAAA ATCTTACTAGCTTTTCTCAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 90} {0: 1, 1: 0, 2: 2, 3: 23, 4: 227}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!