ID: 936080448_936080457

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 936080448 936080457
Species Human (GRCh38) Human (GRCh38)
Location 2:109429268-109429290 2:109429305-109429327
Sequence CCCAGCACATCCATCTGCTTTTG GCACCCAGAGGAAAAAAAGTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 26, 4: 226} {0: 1, 1: 0, 2: 2, 3: 24, 4: 258}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!