ID: 936348165_936348175

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 936348165 936348175
Species Human (GRCh38) Human (GRCh38)
Location 2:111690969-111690991 2:111691011-111691033
Sequence CCAAATAACATCTCATCTTGAGG GGCATCCTAACACCCTGCTGGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!