|
Left Crispr |
Right Crispr |
| Crispr ID |
936379440 |
936379451 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
2:111970829-111970851
|
2:111970874-111970896
|
| Sequence |
CCTCCTCCTTCTCCTCCTTCTCC |
CCTTCTTCTTGTTCTTTTCTTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 50, 1: 652, 2: 4424, 3: 10166, 4: 20383} |
{0: 1, 1: 1, 2: 6, 3: 101, 4: 1027} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|