|
Left Crispr |
Right Crispr |
Crispr ID |
936407022 |
936407029 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
2:112214033-112214055
|
2:112214060-112214082
|
Sequence |
CCCCCTGGGGTTCACACCATTCT |
CCTCAGCCTCCCGAGTAGCTGGG |
Strand |
- |
+ |
Off-target summary |
{0: 18, 1: 377, 2: 450, 3: 646, 4: 1212} |
{0: 99957, 1: 284367, 2: 226920, 3: 125442, 4: 164576} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|