ID: 936436813_936436820

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 936436813 936436820
Species Human (GRCh38) Human (GRCh38)
Location 2:112515174-112515196 2:112515215-112515237
Sequence CCAAAATCTAGATTACCCATGGC CCCTGTGTATGGGCTGCATATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 61} {0: 1, 1: 0, 2: 0, 3: 13, 4: 104}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!