ID: 936518328_936518330

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 936518328 936518330
Species Human (GRCh38) Human (GRCh38)
Location 2:113196522-113196544 2:113196537-113196559
Sequence CCTAGTTATTCCTGGGCCCCAGA GCCCCAGAGTCCCTGTAGTAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 198} {0: 1, 1: 0, 2: 1, 3: 10, 4: 119}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!