ID: 936529186_936529194

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 936529186 936529194
Species Human (GRCh38) Human (GRCh38)
Location 2:113263562-113263584 2:113263603-113263625
Sequence CCCCATTTTATAGATAAAGATGC GGCATGTGCACAGCCAGTTAGGG
Strand - +
Off-target summary {0: 2, 1: 6, 2: 51, 3: 474, 4: 2583} {0: 1, 1: 0, 2: 0, 3: 12, 4: 149}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!