ID: 936553101_936553105

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 936553101 936553105
Species Human (GRCh38) Human (GRCh38)
Location 2:113467738-113467760 2:113467760-113467782
Sequence CCTGAGTCTTAAAGAATGAATAA AGGTTTTTACAGATGGAGTAGGG
Strand - +
Off-target summary {0: 7, 1: 0, 2: 4, 3: 44, 4: 465} {0: 6, 1: 1, 2: 3, 3: 12, 4: 222}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!