ID: 936707653_936707656

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 936707653 936707656
Species Human (GRCh38) Human (GRCh38)
Location 2:115094460-115094482 2:115094499-115094521
Sequence CCTCTAACTTACATCACATGGTA ATCCATAAAATGAAAGGTACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 96} {0: 1, 1: 0, 2: 0, 3: 21, 4: 248}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!