ID: 936722969_936722981

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 936722969 936722981
Species Human (GRCh38) Human (GRCh38)
Location 2:115275955-115275977 2:115276006-115276028
Sequence CCTCCCAAAGTGCTGGGATTACG TAGCATATTTCAACTCTTGGTGG
Strand - +
Off-target summary {0: 2604, 1: 296063, 2: 268467, 3: 154459, 4: 133890} {0: 1, 1: 0, 2: 0, 3: 8, 4: 134}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!