ID: 937119362_937119364

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 937119362 937119364
Species Human (GRCh38) Human (GRCh38)
Location 2:119431419-119431441 2:119431444-119431466
Sequence CCGCAGAGTGAGGGCAGCAGAGC CTGCGCCTGCCTCCTCCCTTCGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!