ID: 937165889_937165890

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 937165889 937165890
Species Human (GRCh38) Human (GRCh38)
Location 2:119816720-119816742 2:119816753-119816775
Sequence CCATAATCTCATTTTGGTTGCTG AAACACTGCTTCATAAAGATAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!