ID: 937408138_937408141

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 937408138 937408141
Species Human (GRCh38) Human (GRCh38)
Location 2:121649360-121649382 2:121649381-121649403
Sequence CCGGGTACTTACAGCCCTGTTTT TTTCGTTACTGTTGCCGCTGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 133} {0: 1, 1: 0, 2: 0, 3: 1, 4: 48}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!