ID: 937907100_937907103

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 937907100 937907103
Species Human (GRCh38) Human (GRCh38)
Location 2:127057770-127057792 2:127057786-127057808
Sequence CCAACATAGACACCAAGACCCCA GACCCCAGGCCACCCCCGAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 197} {0: 1, 1: 0, 2: 0, 3: 29, 4: 191}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!