ID: 937986351_937986360

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 937986351 937986360
Species Human (GRCh38) Human (GRCh38)
Location 2:127639886-127639908 2:127639907-127639929
Sequence CCCTGGATCCCCTAGACCCCCTG TGAACCTGCCCCCATCTCCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 177} {0: 1, 1: 0, 2: 4, 3: 31, 4: 309}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!