ID: 938077580_938077586

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 938077580 938077586
Species Human (GRCh38) Human (GRCh38)
Location 2:128347964-128347986 2:128347993-128348015
Sequence CCCTGCAGTCTTCTTTCTCTGCT TGCTTGGCTTGGCTGCCACAGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!