ID: 938109116_938109128

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 938109116 938109128
Species Human (GRCh38) Human (GRCh38)
Location 2:128552465-128552487 2:128552495-128552517
Sequence CCACCCCAGGCCTGCTGAATCAG ATACTGGTGGGGGGCTGCCCAGG
Strand - +
Off-target summary {0: 4, 1: 55, 2: 273, 3: 881, 4: 2028} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!