ID: 938263188_938263197

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 938263188 938263197
Species Human (GRCh38) Human (GRCh38)
Location 2:129909603-129909625 2:129909620-129909642
Sequence CCCAAAGCCCACTCCACTGTGGG TGTGGGGTTGCAGGACAGGAAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!