ID: 938286242_938286249

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 938286242 938286249
Species Human (GRCh38) Human (GRCh38)
Location 2:130120167-130120189 2:130120185-130120207
Sequence CCTTGCTCTTGCTGCTCCCCCTG CCCTGCAGCAGGGGAAGCAGTGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 8, 3: 94, 4: 703} {0: 18, 1: 14, 2: 6, 3: 84, 4: 835}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!