ID: 938350860_938350880

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 938350860 938350880
Species Human (GRCh38) Human (GRCh38)
Location 2:130597752-130597774 2:130597805-130597827
Sequence CCCGCGCCCCCGCACCCGCGCGC AGACCCGCAGGTCCCTCACCCGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 18, 3: 113, 4: 934} {0: 2, 1: 0, 2: 0, 3: 13, 4: 136}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!