ID: 938537522_938537533

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 938537522 938537533
Species Human (GRCh38) Human (GRCh38)
Location 2:132257823-132257845 2:132257862-132257884
Sequence CCGCTGCGCGTGCGCGCAATCCC CCACCAGCCTCCTTTCTCCCAGG
Strand - +
Off-target summary No data {0: 1, 1: 6, 2: 5, 3: 49, 4: 433}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!