ID: 938583743_938583753

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 938583743 938583753
Species Human (GRCh38) Human (GRCh38)
Location 2:132669999-132670021 2:132670041-132670063
Sequence CCCGGCTGCAGCGGCTGTGGCTG CGCTGCTGCCGCGGAGACGACGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 7, 3: 67, 4: 569} {0: 1, 1: 0, 2: 0, 3: 4, 4: 107}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!