ID: 938898421_938898427

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 938898421 938898427
Species Human (GRCh38) Human (GRCh38)
Location 2:135776270-135776292 2:135776314-135776336
Sequence CCGTCTTCCTGATGGTTCTTCCT ATGCTCCTCTAGAAGAGGCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 50, 4: 481} {0: 1, 1: 0, 2: 1, 3: 10, 4: 135}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!