ID: 939134070_939134075

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 939134070 939134075
Species Human (GRCh38) Human (GRCh38)
Location 2:138273423-138273445 2:138273459-138273481
Sequence CCAGTCAGGAGCAGCAATGGGCG GAGCACAGCAGACACCCTGCTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!