ID: 939189764_939189772

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 939189764 939189772
Species Human (GRCh38) Human (GRCh38)
Location 2:138902404-138902426 2:138902434-138902456
Sequence CCTCGTCTGTTTCGCCCTTCCAG AGCCTTGGCAACGGCAACACTGG
Strand - +
Off-target summary {0: 1, 1: 3, 2: 0, 3: 4, 4: 89} {0: 1, 1: 0, 2: 0, 3: 8, 4: 96}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!