ID: 939456698_939456703

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 939456698 939456703
Species Human (GRCh38) Human (GRCh38)
Location 2:142446330-142446352 2:142446368-142446390
Sequence CCCAGTACTGAGTAGAAGAATGA TGGAACAATAGGAGCACTAAGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!