ID: 939672846_939672856

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 939672846 939672856
Species Human (GRCh38) Human (GRCh38)
Location 2:145034848-145034870 2:145034887-145034909
Sequence CCACCAAAACTCCATACCAATGG TAAGTAGAAATGACAATAGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 118} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!