ID: 939954441_939954446

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 939954441 939954446
Species Human (GRCh38) Human (GRCh38)
Location 2:148514749-148514771 2:148514792-148514814
Sequence CCACAGCACAGAGCATGCCACCT CAGCTCTTAGTTATTCCCCTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 41, 4: 347} {0: 1, 1: 0, 2: 0, 3: 7, 4: 120}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!