ID: 940725053_940725060

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 940725053 940725060
Species Human (GRCh38) Human (GRCh38)
Location 2:157327660-157327682 2:157327697-157327719
Sequence CCAGAGATCCCACAGGGGTTCGG CAGTAGAGACAGTTGTGGCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 64} {0: 1, 1: 0, 2: 1, 3: 32, 4: 324}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!