ID: 940962161_940962169

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 940962161 940962169
Species Human (GRCh38) Human (GRCh38)
Location 2:159797978-159798000 2:159797999-159798021
Sequence CCACGGGGGACGGGCGTGCAGGG GGAAGGGCGGGATGGCCGGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 175} {0: 1, 1: 0, 2: 0, 3: 28, 4: 537}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!