ID: 941181790_941181793

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 941181790 941181793
Species Human (GRCh38) Human (GRCh38)
Location 2:162268142-162268164 2:162268157-162268179
Sequence CCCCAGAACAGGCTAGCACACTG GCACACTGCAGTTTTTGCAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 169} {0: 1, 1: 0, 2: 1, 3: 8, 4: 143}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!