ID: 941701930_941701940

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 941701930 941701940
Species Human (GRCh38) Human (GRCh38)
Location 2:168613059-168613081 2:168613092-168613114
Sequence CCAATGCAGAACTTTGAGGTTTG TAAAGGGGGGTTGAAGGCGAAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!