ID: 941812416_941812423

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 941812416 941812423
Species Human (GRCh38) Human (GRCh38)
Location 2:169768071-169768093 2:169768104-169768126
Sequence CCTTGGGACCTGCAGATCCTGCA CAATTTACCAACTTCGGCAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 33, 4: 333} {0: 1, 1: 0, 2: 0, 3: 3, 4: 54}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!