ID: 942098590_942098598

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 942098590 942098598
Species Human (GRCh38) Human (GRCh38)
Location 2:172556357-172556379 2:172556372-172556394
Sequence CCCGGGACCTTGGGCCTTTTTGC CTTTTTGCGCGGTCCCGGGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 137} {0: 1, 1: 0, 2: 1, 3: 4, 4: 37}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!