ID: 942554737_942554744

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 942554737 942554744
Species Human (GRCh38) Human (GRCh38)
Location 2:177160148-177160170 2:177160191-177160213
Sequence CCTAAACTTTCCATCTTATCTCT CATCAAAGGGAGATCATGGTGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 3, 3: 91, 4: 710}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!