ID: 942632935_942632943

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 942632935 942632943
Species Human (GRCh38) Human (GRCh38)
Location 2:177971623-177971645 2:177971652-177971674
Sequence CCACTGTCTAGACAGAGAGAAGG GGGAAGGAAGAGGAAGAGAGAGG
Strand - +
Off-target summary No data {0: 1, 1: 4, 2: 94, 3: 1056, 4: 6084}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!