ID: 942678849_942678856

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 942678849 942678856
Species Human (GRCh38) Human (GRCh38)
Location 2:178455542-178455564 2:178455560-178455582
Sequence CCCAGGCACACAGGTCCCAGGGC AGGGCATCAGGAGAAAGGCTGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 53, 4: 365} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!